分離済み変異体

tm1137

Allele Nametm1137
BalanceNot Required
OutCrossNot Accepted
Sequence NameT11B7.4
Gene Namealp-1
Worm BaseAllele Name tm1137
Gene Name alp-1
Sequence T11B7.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 16172/16173-GGC-16578/16579 (406 bp deletion + 3 bp insertion)
ChromosomeIV
Putative gene structurejoin(12181..12279, 12786..12931, 14327..14435, 14566..14723, 16142..16312, 16386..16489, 16543..16618, 16670..16840, 16886..17112, Z54235.1:139..1884, Z54235.1:2016..2415, Z54235.1:2542..2732, Z54235.1:3080..3257, Z54235.1:3500..3759, Z54235.1:3810..3973, Z54235.1:4490..4564)
Map position3.99
Balancer
Map position of balancer
Sequence of primersExtFwd:TAAGTCTGCAGCTGAGCAAT,IntFwd:CGGTCGAATTCCGAGTCTCA,ExtRev:GAGCTGGTGACAAGCGGTTA,IntRev:ATCGTAATGAGTACCACCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lesanpezeshki L, Qadota H, Darabad MN, Kashyap K, Lacerda CMR, Szewczyk NJ, Benian GM, Vanapalli SA.
Investigating the correlation of muscle function tests and sarcomere organization in C. elegans.
Skelet Muscle 2021 11(1) 20 
[ PubMed ID = 34389048 ] [ RRC reference ]

Lecroisey C, Brouilly N, Qadota H, Mariol MC, Rochette NC, Martin E, Benian GM, Ségalat L, Mounier N, Gieseler K.
ZYX-1, the unique zyxin protein of Caenorhabditis elegans, is involved in dystrophin-dependent muscle degeneration.
Mol Biol Cell 2013 24(8) 1232-49 
[ PubMed ID = 23427270 ] [ RRC reference ]

Han HF, Beckerle MC.
The ALP-Enigma protein ALP-1 functions in actin filament organization to promote muscle structural integrity in Caenorhabditis elegans.
Mol Biol Cell 2009 20(9) 2361-70 
[ PubMed ID = 19261811 ] [ RRC reference ]