Allele Name | tm1137 |
Allele Type | 通常株 |
Sequence Name | T11B7.4 |
Gene Name | alp-1 |
Worm Base | Allele Name |
tm1137
|
Gene Name |
alp-1
|
Sequence |
T11B7.4
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 16172/16173-GGC-16578/16579 (406 bp deletion + 3 bp insertion) |
Chromosome | IV |
Putative gene structure | join(12181..12279, 12786..12931, 14327..14435, 14566..14723, 16142..16312, 16386..16489, 16543..16618, 16670..16840, 16886..17112, Z54235.1:139..1884, Z54235.1:2016..2415, Z54235.1:2542..2732, Z54235.1:3080..3257, Z54235.1:3500..3759, Z54235.1:3810..3973, Z54235.1:4490..4564) |
Map position | 3.99 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:TAAGTCTGCAGCTGAGCAAT,IntFwd:CGGTCGAATTCCGAGTCTCA,ExtRev:GAGCTGGTGACAAGCGGTTA,IntRev:ATCGTAATGAGTACCACCTG |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Lesanpezeshki L, Qadota H, Darabad MN, Kashyap K, Lacerda CMR, Szewczyk NJ, Benian GM, Vanapalli SA. Investigating the correlation of muscle function tests and sarcomere organization in C. elegans. Skelet Muscle 2021 11(1) 20
[ PubMed ID = 34389048 ]
[ RRC reference ]
|
Lecroisey C, Brouilly N, Qadota H, Mariol MC, Rochette NC, Martin E, Benian GM, Ségalat L, Mounier N, Gieseler K. ZYX-1, the unique zyxin protein of Caenorhabditis elegans, is involved in dystrophin-dependent muscle degeneration. Mol Biol Cell 2013 24(8) 1232-49
[ PubMed ID = 23427270 ]
[ RRC reference ]
|
Han HF, Beckerle MC. The ALP-Enigma protein ALP-1 functions in actin filament organization to promote muscle structural integrity in Caenorhabditis elegans. Mol Biol Cell 2009 20(9) 2361-70
[ PubMed ID = 19261811 ]
[ RRC reference ]
|
|