分離済み変異体

tm1133

Allele Nametm1133
BalanceNot Required
OutCrossNot Accepted
Sequence NameZK1248.14
Gene Namefzo-1
Worm BaseAllele Name tm1133
Gene Name fzo-1
Sequence ZK1248.14
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. J-C. Martinou: not hypersensitive to anoxia, a bit slow growth at 20 degree. Dr. Xue: Mol Cell 31, 586 (2008). Dr. T. Oka: J. Biochem. 143, 449 (2008). Dr. H. Sawa: normal embryonic cell division.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 26031/26032-GTTCAGCCACATTG-26450/26451 (419 bp deletion + 14 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(24019..24100, 24149..24283, 24330..24800, 24846..24957, 25007..26114, 26166..26383, 26435..26560, 26607..26679))
Map position-0.87
Balancer
Map position of balancer
Sequence of primersExtFwd:GCTCTGTCTGCTCACGGTAA,IntFwd:GTCCTGGTGGATTCGTTTAG,ExtRev:CTCATTGCATGTACGGTGTA,IntRev:GAACGGGGGCTTGCTGATTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Spector E, Michaeli L, Nitzan A, Grobe H, Axel G, Abu-Shach UB, Zinger H, Carvalho CA, Zaidel-Bar R, Broday L.
The Juvenile Parkinson's Disease Mutation C212Y Impairs Mitochondrial Homeostasis in a Caenorhabditis elegans Model.
FASEB J 2025 39(16) e70835 
[ PubMed ID = 40873184 ] [ RRC reference ]

Segos I, Van Eeckhoven J, Berger S, Mishra N, Lambie EJ, Conradt B.
Unequal segregation of mitochondria during asymmetric cell division contributes to cell fate divergence in sister cells in vivo.
Nat Commun 2025 16(1) 7174 
[ PubMed ID = 40759648 ] [ RRC reference ]

Obinata H, Watanabe T, Takahashi H, Shimo S, Oda T, Sugimoto A, Niwa S.
SLC-25A46 regulates mitochondrial fusion through the mitofusin protein FZO-1 and is essential for maintaining neuronal morphology.
J Cell Sci 2025 138(12)  
[ PubMed ID = 40444356 ] [ RRC reference ]

Sun L, Liu J, Lu M, Zhou Y, Guo S, Qin Z, Wang Z, Sun X.
Inactivation of SIAH-1 E3 ligase attenuates Aβ toxicity by suppressing ubiquitin-dependent DVE-1 degradation in Caenorhabditis elegans models of Alzheimer's disease.
J Biol Chem 2025 301(6) 110226 
[ PubMed ID = 40349774 ] [ RRC reference ]

Traa A, Tamez González AA, Van Raamsdonk JM.
Developmental disruption of the mitochondrial fission gene drp-1 extends the longevity of daf-2 insulin/IGF-1 receptor mutant.
Geroscience 2025 47(1) 877-902 
[ PubMed ID = 39028454 ] [ RRC reference ]

Wu Z, Cardona EA, Cohn JA, Pierce JT.
Nonapoptotic role of EGL-1 in exopher production and neuronal health in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2025 122(2) e2407909122 
[ PubMed ID = 39786930 ] [ RRC reference ]

Chen L, Chen G, Gai T, Zhou X, Zhu J, Wang R, Wang X, Guo Y, Wang Y, Xie Z.
L-Theanine Prolongs the Lifespan by Activating Multiple Molecular Pathways in Ultraviolet C-Exposed Caenorhabditis elegans.
Molecules 2024 29(11)  
[ PubMed ID = 38893565 ] [ RRC reference ]

Wu Z, Cardona EA, Pierce JT.
Non-apoptotic role of EGL-1 in exopher production and neuronal health in Caenorhabditis elegans.
bioRxiv 2024   
[ PubMed ID = 38712027 ] [ RRC reference ]

Cooper JF, Nguyen K, Gates D, Wolfrum E, Capan C, Lee H, Williams D, Okoye C, Wojtovich AP, Burton NO.
Oocyte mitochondria link maternal environment to offspring phenotype.
Res Sq 2024   
[ PubMed ID = 38585755 ] [ RRC reference ]

Michaeli L, Spector E, Haeussler S, Carvalho CA, Grobe H, Abu-Shach UB, Zinger H, Conradt B, Broday L.
ULP-2 SUMO protease regulates UPRmt and mitochondrial homeostasis in Caenorhabditis elegans.
Free Radic Biol Med 2024 214 19-27 
[ PubMed ID = 38301974 ] [ RRC reference ]

Sharifi S, Chaudhari P, Martirosyan A, Eberhardt AO, Witt F, Gollowitzer A, Lange L, Woitzat Y, Okoli EM, Li H, Rahnis N, Kirkpatrick J, Werz O, Ori A, Koeberle A, Bierhoff H, Ermolaeva M.
Reducing the metabolic burden of rRNA synthesis promotes healthy longevity in Caenorhabditis elegans.
Nat Commun 2024 15(1) 1702 
[ PubMed ID = 38402241 ] [ RRC reference ]

Zhang R, Fang J, Qi T, Zhu S, Yao L, Fang G, Li Y, Zang X, Xu W, Hao W, Liu S, Yang D, Chen D, Yang J, Ma X, Wu L.
Maternal aging increases offspring adult body size via transmission of donut-shaped mitochondria.
Cell Res 2023 33(11) 821-834 
[ PubMed ID = 37500768 ] [ RRC reference ]

Ren X, Zhou H, Sun Y, Fu H, Ran Y, Yang B, Yang F, Bjorklund M, Xu S.
MIRO-1 interacts with VDAC-1 to regulate mitochondrial membrane potential in Caenorhabditis elegans.
EMBO Rep 2023 24(8) e56297 
[ PubMed ID = 37306041 ] [ RRC reference ]

Campos JC, Marchesi Bozi LH, Krum B, Grassmann Bechara LR, Ferreira ND, Arini GS, Albuquerque RP, Traa A, Ogawa T, van der Bliek AM, Beheshti A, Chouchani ET, Van Raamsdonk JM, Blackwell TK, Ferreira JCB.
Exercise preserves physical fitness during aging through AMPK and mitochondrial dynamics.
Proc Natl Acad Sci U S A 2023 120(2) e2204750120 
[ PubMed ID = 36595699 ] [ RRC reference ]

Cota V, Sohrabi S, Kaletsky R, Murphy CT.
Oocyte mitophagy is critical for extended reproductive longevity.
PLoS Genet 2022 18(9) e1010400 
[ PubMed ID = 36126046 ] [ RRC reference ]

Meshnik L, Bar-Yaacov D, Kasztan D, Neiger T, Cohen T, Kishner M, Valenci I, Dadon S, Klein CJ, Vance JM, Nevo Y, Züchner S, Ovadia O, Mishmar D, Ben-Zvi A.
Mutant C. elegans mitofusin leads to selective removal of mtDNA heteroplasmic deletions across generations to maintain fitness.
BMC Biol 2022 20(1) 40 
[ PubMed ID = 35139855 ] [ RRC reference ]

Rolland S, Conradt B.
Genetic screen identifies non-mitochondrial proteins involved in the maintenance of mitochondrial homeostasis.
MicroPubl Biol 2022 2022  
[ PubMed ID = 35622507 ] [ RRC reference ]

Chung KW, Kim JS, Lee KS.
A Database of Caenorhabditis elegans Locomotion and Body Posture Phenotypes for the Peripheral Neuropathy Model.
Mol Cells 2020 43(10) 880-888 
[ PubMed ID = 33115980 ] [ RRC reference ]

Machiela E, Liontis T, Dues DJ, Rudich PD, Traa A, Wyman L, Kaufman C, Cooper JF, Lew L, Nadarajan S, Senchuk MM, Van Raamsdonk JM.
Disruption of mitochondrial dynamics increases stress resistance through activation of multiple stress response pathways.
FASEB J 2020 34(6) 8475-8492 
[ PubMed ID = 32385951 ] [ RRC reference ]

Oh KH, Sheoran S, Richmond JE, Kim H.
Alcohol induces mitochondrial fragmentation and stress responses to maintain normal muscle function in Caenorhabditis elegans.
FASEB J 2020 34(6) 8204-8216 
[ PubMed ID = 32294300 ] [ RRC reference ]