Allele Name | tm1130 |
Allele Type | 通常株 |
Sequence Name | T22C8.5 |
Gene Name | sptf-2 |
Worm Base | Allele Name |
tm1130
|
Gene Name |
sptf-2
|
Sequence |
T22C8.5
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. H. Sawa: non Psa. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 13681/13682-14270/14271 (589 bp deletion) |
Chromosome | II |
Putative gene structure | join(12937..13133, 14103..14201, 14286..14396, 14608..14701) |
Map position | 0.83 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntRev:CCTCGATCGCCATGCTTTCT,ExtFwd:GTATGCAATTCCCGTCCCCA,IntFwd:GTTGCCACGAATCTCAGAGT,ExtRev:GGTGAGTGTGTTGAGACCCT |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Jackson BM, Abete-Luzi P, Krause MW, Eisenmann DM. Use of an activated beta-catenin to identify Wnt pathway target genes in caenorhabditis elegans, including a subset of collagen genes expressed in late larval development. G3 (Bethesda) 2014 4(4) 733-47
[ PubMed ID = 24569038 ]
[ RRC reference ]
|
González-Barrios M, Fierro-González JC, Krpelanova E, Mora-Lorca JA, Pedrajas JR, Peñate X, Chavez S, Swoboda P, Jansen G, Miranda-Vizuete A. Cis- and trans-regulatory mechanisms of gene expression in the ASJ sensory neuron of Caenorhabditis elegans. Genetics 2015 200(1) 123-34
[ PubMed ID = 25769980 ]
[ RRC reference ]
|
|