分離済み変異体

tm1130

Allele Nametm1130
BalanceNot Required
OutCrossNot Accepted
Sequence NameT22C8.5
Gene Namesptf-2
Worm BaseAllele Name tm1130
Gene Name sptf-2
Sequence T22C8.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H. Sawa: non Psa.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 13681/13682-14270/14271 (589 bp deletion)
ChromosomeII
Putative gene structurejoin(12937..13133, 14103..14201, 14286..14396, 14608..14701)
Map position0.83
Balancer
Map position of balancer
Sequence of primersIntRev:CCTCGATCGCCATGCTTTCT,ExtFwd:GTATGCAATTCCCGTCCCCA,IntFwd:GTTGCCACGAATCTCAGAGT,ExtRev:GGTGAGTGTGTTGAGACCCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
González-Barrios M, Fierro-González JC, Krpelanova E, Mora-Lorca JA, Pedrajas JR, Peñate X, Chavez S, Swoboda P, Jansen G, Miranda-Vizuete A.
Cis- and trans-regulatory mechanisms of gene expression in the ASJ sensory neuron of Caenorhabditis elegans.
Genetics 2015 200(1) 123-34 
[ PubMed ID = 25769980 ] [ RRC reference ]

Jackson BM, Abete-Luzi P, Krause MW, Eisenmann DM.
Use of an activated beta-catenin to identify Wnt pathway target genes in caenorhabditis elegans, including a subset of collagen genes expressed in late larval development.
G3 (Bethesda) 2014 4(4) 733-47 
[ PubMed ID = 24569038 ] [ RRC reference ]