分離済み変異体

tm1127

Allele Nametm1127
BalanceNot Required
OutCrossNot Accepted
Sequence NameY49F6A.1
Gene Namewago-11
Worm BaseAllele Name tm1127
Gene Name wago-11
Sequence Y49F6A.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 16762/16763-GN-17485/17486 (723 bp deletion + 2 bp insertion)
ChromosomeII
Putative gene structurejoin(16538..16583, 16650..16733, 17122..17335, 17386..18118, 18275..18484, 18533..18846, 19031..19627, 19676..20027, 20087..20277, 20376..20535)
Map position-6.24
Balancer
Map position of balancer
Sequence of primersExtRev:AGTCATGGCGGATTGCTGAA,IntRev:AGCTTAAGTCTGACCACGTT,ExtFwd:TGGAATCGAAAGCGAACGTC,IntFwd:ATCAAGAGCCATACCGCATC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ow MC, Nishiguchi MA, Dar AR, Butcher RA, Hall SE.
RNAi-dependent expression of sperm genes in ADL chemosensory neurons is required for olfactory responses in Caenorhabditis elegans.
Front Mol Biosci 2024 11 1396587 
[ PubMed ID = 39055986 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
mBio 2017 8(5)  
[ PubMed ID = 29018118 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32 
[ PubMed ID = 24532782 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19 
[ PubMed ID = 23329696 ] [ RRC reference ]

Luteijn MJ, van Bergeijk P, Kaaij LJ, Almeida MV, Roovers EF, Berezikov E, Ketting RF.
Extremely stable Piwi-induced gene silencing in Caenorhabditis elegans.
EMBO J 2012 31(16) 3422-30 
[ PubMed ID = 22850670 ] [ RRC reference ]