分離済み変異体

tm1125

Allele Name

tm1125

Balance

Not Required

OutCross

Not Accepted

Sequence Name

W06B4.3

Gene Name

W06B4.3

Worm Base

Allele Name

tm1125

Gene Name

W06B4.3

Sequence

W06B4.3

Phenotype

homozygous viable. Dr. G. Herman: unable to score because of inviablity. Dr. M. Barr: small body size, few dauers observed on starved plate, male mating behavior abnormal. Dr. C. Yang: slightly Dpy, cell corpses degradation defects. Dr. J. Kaplan: Gro, small brood size. Dr. Z. Zhou: persistent cell corpses in adult gonad.

Mutation site

703/704-1287/1288 (584 bp deletion)

Chromosome

Putative gene structure

join(100..878, 1507..1893, 2550..3375, 4221..4614, 5494..6073, 6335..6401)

Map position

-4.38

Balancer

Map position of balancer

Sequence of primers

ExtRev:CTCATATAAACAGCTGCGGT,IntRev:GCGGTAAGGCTGGAAGGGAA,ExtFwd:TACAGCGAAGGCACTGGGGA,IntFwd:CTGGGGAGAGGCATCAAGGT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Zhang R, Fang J, Qi T, Zhu S, Yao L, Fang G, Li Y, Zang X, Xu W, Hao W, Liu S, Yang D, Chen D, Yang J, Ma X, Wu L.
Maternal aging increases offspring adult body size via transmission of donut-shaped mitochondria.
Cell Res 2023 33(11) 821-834
[ PubMed ID = 37500768 ] [ RRC reference ]

Ma A, Feng Q, Li P, Yuan L, Xiao H.
SCAV-3 affects apoptotic cell degradation in Caenorhabditis elegans.
FEBS Open Bio 2023 13(5) 867-880
[ PubMed ID = 36947094 ] [ RRC reference ]

Sang L, Dong R, Liu R, Hao Q, Bai W, Sun J.
Caenorhabditis elegans NHR-14/HNF4α regulates DNA damage-induced apoptosis through cooperating with cep-1/p53.
Cell Commun Signal 2022 20(1) 135
[ PubMed ID = 36050770 ] [ RRC reference ]

Peña-Ramos O, Chiao L, Liu X, Yu X, Yao T, He H, Zhou Z.
Autophagosomes fuse to phagosomes and facilitate the degradation of apoptotic cells in Caenorhabditis elegans.
Elife 2022 11
[ PubMed ID = 34982028 ] [ RRC reference ]

Wan J, Yuan L, Jing H, Zheng Q, Xiao H.
Defective apoptotic cell clearance activates innate immune response to protect Caenorhabditis elegans against pathogenic bacteria.
Virulence 2021 12(1) 75-83
[ PubMed ID = 33372828 ] [ RRC reference ]

Li Y, Zhang Y, Gan Q, Xu M, Ding X, Tang G, Liang J, Liu K, Liu X, Wang X, Guo L, Gao Z, Hao X, Yang C.
C. elegans-based screen identifies lysosome-damaging alkaloids that induce STAT3-dependent lysosomal cell death.
Protein Cell 2018 9(12) 1013-1026
[ PubMed ID = 29611115 ] [ RRC reference ]

Morris C, Foster OK, Handa S, Peloza K, Voss L, Somhegyi H, Jian Y, Vo MV, Harp M, Rambo FM, Yang C, Hermann GJ.
Function and regulation of the Caenorhabditis elegans Rab32 family member GLO-1 in lysosome-related organelle biogenesis.
PLoS Genet 2018 14(11) e1007772
[ PubMed ID = 30419011 ] [ RRC reference ]

Liu K, Jian Y, Sun X, Yang C, Gao Z, Zhang Z, Liu X, Li Y, Xu J, Jing Y, Mitani S, He S, Yang C.
Negative regulation of phosphatidylinositol 3-phosphate levels in early-to-late endosome conversion.
J Cell Biol 2016 212(2) 181-98
[ PubMed ID = 26783301 ] [ RRC reference ]

Solinger JA, Spang A.
Loss of the Sec1/Munc18-family proteins VPS-33.2 and VPS-33.1 bypasses a block in endosome maturation in Caenorhabditis elegans.
Mol Biol Cell 2014 25(24) 3909-25
[ PubMed ID = 25273556 ] [ RRC reference ]

Xu M, Liu Y, Zhao L, Gan Q, Wang X, Yang C.
The lysosomal cathepsin protease CPL-1 plays a leading role in phagosomal degradation of apoptotic cells in Caenorhabditis elegans.
Mol Biol Cell 2014 25(13) 2071-83
[ PubMed ID = 24829385 ] [ RRC reference ]

Delahaye JL, Foster OK, Vine A, Saxton DS, Curtin TP, Somhegyi H, Salesky R, Hermann GJ.
Caenorhabditis elegans HOPS and CCZ-1 mediate trafficking to lysosome-related organelles independently of RAB-7 and SAND-1.
Mol Biol Cell 2014 25(7) 1073-96
[ PubMed ID = 24501423 ] [ RRC reference ]

Maekawa M, Terasaka S, Mochizuki Y, Kawai K, Ikeda Y, Araki N, Skolnik EY, Taguchi T, Arai H.
Sequential breakdown of 3-phosphorylated phosphoinositides is essential for the completion of macropinocytosis.
Proc Natl Acad Sci U S A 2014 111(11) E978-87
[ PubMed ID = 24591580 ] [ RRC reference ]

Wu YE, Huo L, Maeder CI, Feng W, Shen K.
The balance between capture and dissociation of presynaptic proteins controls the spatial distribution of synapses.
Neuron 2013 78(6) 994-1011
[ PubMed ID = 23727120 ] [ RRC reference ]

Chen D, Jian Y, Liu X, Zhang Y, Liang J, Qi X, Du H, Zou W, Chen L, Chai Y, Ou G, Miao L, Wang Y, Yang C.
Clathrin and AP2 are required for phagocytic receptor-mediated apoptotic cell clearance in Caenorhabditis elegans.
PLoS Genet 2013 9(5) e1003517
[ PubMed ID = 23696751 ] [ RRC reference ]

Xu J, Sun X, Jing Y, Wang M, Liu K, Jian Y, Yang M, Cheng Z, Yang C.
MRG-1 is required for genomic integrity in Caenorhabditis elegans germ cells.
Cell Res 2012 22(5) 886-902
[ PubMed ID = 22212480 ] [ RRC reference ]

Xiao H, Chen D, Fang Z, Xu J, Sun X, Song S, Liu J, Yang C.
Lysosome biogenesis mediated by vps-18 affects apoptotic cell degradation in Caenorhabditis elegans.
Mol Biol Cell 2009 20(1) 21-32
[ PubMed ID = 18923146 ] [ RRC reference ]