分離済み変異体

tm1120

Allele Nametm1120
BalanceNot Required
OutCrossNot Accepted
Sequence NameY110A7A.18
Gene Nameppw-2
Worm BaseAllele Name tm1120
Gene Name ppw-2
Sequence Y110A7A.18
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 59817/59818-60762/60763 (945 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(58180..58297, 58349..58716, 58764..59006, 59051..59225, 59272..59440, 59485..59660, 59709..60432, 60477..60882, 60927..61095, 61144..61334, 61381..61569))
Map position-0.35
Balancer
Map position of balancer
Sequence of primersIntRev:CGGTTCCACCGGTAACAATG,ExtRev:ACAATGCCTGCTACACCGGT,IntFwd:CGATAGCATCAGGGGTGAGA,ExtFwd:CGCAGCCTCACGCAAACGAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Harvey LM, Frédérick PM, Gudipati RK, Michaud P, Houle F, Young D, Desbiens C, Ladouceur S, Dufour A, Großhans H, Simard MJ.
Dipeptidyl peptidase DPF-3 is a gatekeeper of microRNA Argonaute compensation in animals.
Nat Commun 2025 16(1) 2738 
[ PubMed ID = 40108168 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Ow MC, Nishiguchi MA, Dar AR, Butcher RA, Hall SE.
RNAi-dependent expression of sperm genes in ADL chemosensory neurons is required for olfactory responses in Caenorhabditis elegans.
Front Mol Biosci 2024 11 1396587 
[ PubMed ID = 39055986 ] [ RRC reference ]

Marnik EA, Almeida MV, Cipriani PG, Chung G, Caspani E, Karaulanov E, Gan HH, Zinno J, Isolehto IJ, Kielisch F, Butter F, Sharp CS, Flanagan RM, Bonnet FX, Piano F, Ketting RF, Gunsalus KC, Updike DL.
The Caenorhabditis elegans TDRD5/7-like protein, LOTR-1, interacts with the helicase ZNFX-1 to balance epigenetic signals in the germline.
PLoS Genet 2022 18(6) e1010245 
[ PubMed ID = 35657999 ] [ RRC reference ]

Placentino M, de Jesus Domingues AM, Schreier J, Dietz S, Hellmann S, de Albuquerque BF, Butter F, Ketting RF.
Intrinsically disordered protein PID-2 modulates Z granules and is required for heritable piRNA-induced silencing in the Caenorhabditis elegans embryo.
EMBO J 2021 40(3) e105280 
[ PubMed ID = 33231880 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32 
[ PubMed ID = 24532782 ] [ RRC reference ]

Vasale JJ, Gu W, Thivierge C, Batista PJ, Claycomb JM, Youngman EM, Duchaine TF, Mello CC, Conte D Jr.
Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway.
Proc Natl Acad Sci U S A 2010 107(8) 3582-7 
[ PubMed ID = 20133583 ] [ RRC reference ]

Gu W, Shirayama M, Conte D Jr, Vasale J, Batista PJ, Claycomb JM, Moresco JJ, Youngman EM, Keys J, Stoltz MJ, Chen CC, Chaves DA, Duan S, Kasschau KD, Fahlgren N, Yates JR 3rd, Mitani S, Carrington JC, Mello CC.
Distinct argonaute-mediated 22G-RNA pathways direct genome surveillance in the C. elegans germline.
Mol Cell 2009 36(2) 231-44 
[ PubMed ID = 19800275 ] [ RRC reference ]

She X, Xu X, Fedotov A, Kelly WG, Maine EM.
Regulation of heterochromatin assembly on unpaired chromosomes during Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway.
PLoS Genet 2009 5(8) e1000624 
[ PubMed ID = 19714217 ] [ RRC reference ]