分離済み変異体

tm1116

Allele Name

tm1116

Balance

Not Required

OutCross

Not Accepted

Sequence Name

R04A9.2

Gene Name

nrde-3

Worm Base

Allele Name

tm1116

Gene Name

nrde-3

Sequence

R04A9.2

Phenotype

homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).

Mutation site

300/301-749/750 (449 bp deletion)

Chromosome

Putative gene structure

join(585..843, 890..1067, 1117..1396, 1745..2355, 2408..2618, 2827..3155, 3203..3396, 3721..4126, 4173..4524, 4581..4771, 4820..4982)

Map position

-20.06

Balancer

Map position of balancer

Sequence of primers

ExtFwd:CAGCGATGAAGGAGGAGTCT,IntFwd:CCCCGATAACCGATCGATAC,ExtRev:ATCACGCGGTGAGCGTCTAT,IntRev:TCTACTGTTCCCGCCGCCAT

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Ewe CK, Teichman G, Weiss S, Knott MML, Anava S, Gingold H, Sarmiento MB, Troemel E, Rechavi O.
Dynamic control of Argonautes by a rapidly evolving immunological switch.
Curr Biol 2025 35(13) 3076-3089.e5
[ PubMed ID = 40494360 ] [ RRC reference ]

Shugarts Devanapally NM, Sathya A, Yi AL, Chan WM, Marre JA, Jose AM.
Intergenerational transport of double-stranded RNA in C. elegans can limit heritable epigenetic changes.
Elife 2025 13
[ PubMed ID = 39902803 ] [ RRC reference ]

Knudsen-Palmer DR, Raman P, Ettefa F, De Ravin L, Jose AM.
Target-specific requirements for RNA interference can arise through restricted RNA amplification despite the lack of specialized pathways.
Elife 2024 13
[ PubMed ID = 39161220 ] [ RRC reference ]

Deshe N, Eliezer Y, Hoch L, Itskovits E, Bokman E, Ben-Ezra S, Zaslaver A.
Inheritance of associative memories and acquired cellular changes in C. elegans.
Nat Commun 2023 14(1) 4232
[ PubMed ID = 37454110 ] [ RRC reference ]

Delaney CE, Methot SP, Kalck V, Seebacher J, Hess D, Gasser SM, Padeken J.
SETDB1-like MET-2 promotes transcriptional silencing and development independently of its H3K9me-associated catalytic activity.
Nat Struct Mol Biol 2022 29(2) 85-96
[ PubMed ID = 35102319 ] [ RRC reference ]

Padeken J, Methot S, Zeller P, Delaney CE, Kalck V, Gasser SM.
Argonaute NRDE-3 and MBT domain protein LIN-61 redundantly recruit an H3K9me3 HMT to prevent embryonic lethality and transposon expression.
Genes Dev 2021 35(1-2) 82-101
[ PubMed ID = 33303642 ] [ RRC reference ]

Saldi TK, Gonzales P, Garrido-Lecca A, Dostal V, Roberts CM, Petrucelli L, Link CD.
The Caenorhabditis elegans Ortholog of TDP-43 Regulates the Chromatin Localization of the Heterochromatin Protein 1 Homolog HPL-2.
Mol Cell Biol 2018 38(15)
[ PubMed ID = 29760282 ] [ RRC reference ]

Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y.
A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans.
Neuron 2018 97(3) 511-519.e6
[ PubMed ID = 29395906 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
mBio 2017 8(5)
[ PubMed ID = 29018118 ] [ RRC reference ]

Le HH, Looney M, Strauss B, Bloodgood M, Jose AM.
Tissue homogeneity requires inhibition of unequal gene silencing during development.
J Cell Biol 2016 214(3) 319-31
[ PubMed ID = 27458132 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32
[ PubMed ID = 24532782 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19
[ PubMed ID = 23329696 ] [ RRC reference ]

Bagijn MP, Goldstein LD, Sapetschnig A, Weick EM, Bouasker S, Lehrbach NJ, Simard MJ, Miska EA.
Function, targets, and evolution of Caenorhabditis elegans piRNAs.
Science 2012 337(6094) 574-578
[ PubMed ID = 22700655 ] [ RRC reference ]