| Allele Name | tm1111 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F13B10.1a |
| Gene Name | tir-1 |
| Worm Base | Allele Name |
tm1111
|
| Gene Name |
tir-1
|
| Sequence |
F13B10.1a
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. C. Bargmann: Genes & Dev.19, 270-281, 2005. Dr. J. Ewbank: normal induction of nlp-29 after infection by D. coniospora. Dr. R. Shingai: normal chemotaxis to simultaneously presented Na-acetate and diacetyl. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 13185/13186-ATGAAANANAACAA-13973/13974 (788 bp deletion + 14 bp insertion) |
| Chromosome | III |
| Putative gene structure | complement(join(1550..1644, 1693..1810, 1967..3001, 11483..11597, 11646..12023, 12324..12442, 12490..12720, 12998..13372, 13674..13914, 22291..22376)) |
| Map position | -4.25 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:CGTGTCGAAGGATGTCGGGA,ExtFwd:TAGGATGTTGGCCAACGCAA,IntRev:GGAACAACGGCGCCACCTAA,ExtRev:TCCTGGAGATCGCCTCTGCA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Shivers RP, Kooistra T, Chu SW, Pagano DJ, Kim DH.
Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans.
Cell Host Microbe 2009 6(4) 321-30
[ PubMed ID = 19837372 ]
[ RRC reference ]
|
Pujol N, Cypowyj S, Ziegler K, Millet A, Astrain A, Goncharov A, Jin Y, Chisholm AD, Ewbank JJ.
Distinct innate immune responses to infection and wounding in the C. elegans epidermis.
Curr Biol 2008 18(7) 481-9
[ PubMed ID = 18394898 ]
[ RRC reference ]
|
Bauer Huang SL, Saheki Y, VanHoven MK, Torayama I, Ishihara T, Katsura I, van der Linden A, Sengupta P, Bargmann CI.
Left-right olfactory asymmetry results from antagonistic functions of voltage-activated calcium channels and the Raw repeat protein OLRN-1 in C. elegans.
Neural Dev 2007 2 24
[ PubMed ID = 17986337 ]
[ RRC reference ]
|
Ceron J, Rual JF, Chandra A, Dupuy D, Vidal M, van den Heuvel S.
Large-scale RNAi screens identify novel genes that interact with the C. elegans retinoblastoma pathway as well as splicing-related components with synMuv B activity.
BMC Dev Biol 2007 7 30
[ PubMed ID = 17417969 ]
[ RRC reference ]
|
Chuang CF, Bargmann CI.
A Toll-interleukin 1 repeat protein at the synapse specifies asymmetric odorant receptor expression via ASK1 MAPKKK signaling.
Genes Dev 2005 19(2) 270-81
[ PubMed ID = 15625192 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.