分離済み変異体

tm1108

Allele Nametm1108
BalanceNot Required
OutCrossNot Accepted
Sequence NameT12E12.4
Gene Namedrp-1
Worm BaseAllele Name tm1108
Gene Name drp-1
Sequence T12E12.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H-S. Koo: embryonic lethality of 15%, L1-L3 larval arrest of lethality of 60%. Dr. A. van der Bliek: Sma, Gro. normal locomotion. connected mitochondria in muscle and hypodermal cells. Dr. D. Xue: slow growth but not lethal or sterile. Mol Cell, 31, 586 (2008). Dr. J. Kaplan: resistant to aldicarb.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1053/1054-CTCCAGCGAACCAGGATT-1477/1478 (425 bp deletion + 18 bp insertion)
ChromosomeIV
Putative gene structurejoin(429..741, 792..1357, 1403..2152, 2269..2419, 2470..2559, 2612..2706, 2758..2874, 2924..2956, 3004..3012)
Map position1.82
Balancer
Map position of balancer
Sequence of primersExtFwd:TGAGTAAGTGGCAGGATCGA,IntFwd:CGAAGGCCAAGTAGACTATC,ExtRev:GAGGTTAAGCCCATGCAATA,IntRev:CCCAGTCAGTCATCCGCACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dennis N, Vazquez-Prada M, Freeman LM, Xue F, White LJ, Karamalegos AA, Sullivan WG, Kudzminkaite B, Brown I, Hiscock JR, Ezcurra M.
A microbial community that alters mitochondrial morphology and age-related motor function in C. elegans.
iScience 2025 28(12) 114128 
[ PubMed ID = 41438044 ] [ RRC reference ]

Mondal M, Scifo E, Ciliberti RE, Wischhof L, Abbariki TN, Jackson J, Menegatou IM, Zeisler-Diehl V, Riemer J, Jussila B, Hopkins CE, Kierszniowska S, Schreiber L, Nicotera P, Ehninger D, Bano D.
Dietary lipid content modifies wah-1/AIFM1-associated phenotypes via LRK-1 and DRP-1 expression in C. elegans.
Nat Commun 2025 16(1) 10817 
[ PubMed ID = 41326385 ] [ RRC reference ]

Roussos A, Kitopoulou K, Borbolis F, Ploumi C, Gianniou DD, Li Z, He H, Tsakiri E, Borland H, Kostakis IK, Samiotaki M, Trougakos IP, Bohr VA, Palikaras K.
Urolithin Α modulates inter-organellar communication via calcium-dependent mitophagy to promote healthy ageing.
Autophagy 2025 21(12) 3097-3122 
[ PubMed ID = 40944367 ] [ RRC reference ]

Barbosa DJ, Santos IC, Moyisyeyenko T, Mendes C, Sobral AF.
C. elegans as a powerful model for neurotoxicity assessment.
Neurotoxicology 2025 110 85-110 
[ PubMed ID = 40721045 ] [ RRC reference ]

Segos I, Van Eeckhoven J, Berger S, Mishra N, Lambie EJ, Conradt B.
Unequal segregation of mitochondria during asymmetric cell division contributes to cell fate divergence in sister cells in vivo.
Nat Commun 2025 16(1) 7174 
[ PubMed ID = 40759648 ] [ RRC reference ]

Obinata H, Watanabe T, Takahashi H, Shimo S, Oda T, Sugimoto A, Niwa S.
SLC-25A46 regulates mitochondrial fusion through the mitofusin protein FZO-1 and is essential for maintaining neuronal morphology.
J Cell Sci 2025 138(12)  
[ PubMed ID = 40444356 ] [ RRC reference ]

Yang X, Wei R, Meng F, Liu D, Gong X, Ruvkun G, Wei W.
Mitochondrial fission surveillance is coupled to Caenorhabditis elegans DNA and chromosome segregation integrity.
PLoS Genet 2025 21(4) e1011678 
[ PubMed ID = 40279356 ] [ RRC reference ]

Munden AL, Lui DS, Higgins DP, Fanelli MJ, Ngyuen TK, Edwards KM, Ericsson M, Godbole AA, Haley JA, Lewis C, Spinelli JB, Harrison B, Raftery D, Djukovic D, Promislow DEL, Miller DL, Walker AK.
Functional Specialization of S-Adenosylmethionine Synthases Links Phosphatidylcholine to Mitochondrial Function and Stress Survival.
bioRxiv 2025   
[ PubMed ID = 40027629 ] [ RRC reference ]

Traa A, Tamez González AA, Van Raamsdonk JM.
Developmental disruption of the mitochondrial fission gene drp-1 extends the longevity of daf-2 insulin/IGF-1 receptor mutant.
Geroscience 2025 47(1) 877-902 
[ PubMed ID = 39028454 ] [ RRC reference ]

Wang S, Xue D.
Asymmetric partitioning of persistent paternal mitochondria during cell divisions safeguards embryo development and mitochondrial inheritance.
Dev Cell 2025   
[ PubMed ID = 39904343 ] [ RRC reference ]

Wu Z, Cardona EA, Cohn JA, Pierce JT.
Nonapoptotic role of EGL-1 in exopher production and neuronal health in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2025 122(2) e2407909122 
[ PubMed ID = 39786930 ] [ RRC reference ]

Matsunaga Y, Qadota H, Ghazal N, Lesanpezeshki L, Dorendorf T, Moody JC, Ahier A, Matheny CJ, Vanapalli SA, Zuryn S, Mayans O, Kwong JQ, Benian GM.
Protein kinase 2 of the giant sarcomeric protein UNC-89 regulates mitochondrial morphology and function.
Commun Biol 2024 7(1) 1342 
[ PubMed ID = 39420071 ] [ RRC reference ]

Chen L, Chen G, Gai T, Zhou X, Zhu J, Wang R, Wang X, Guo Y, Wang Y, Xie Z.
L-Theanine Prolongs the Lifespan by Activating Multiple Molecular Pathways in Ultraviolet C-Exposed Caenorhabditis elegans.
Molecules 2024 29(11)  
[ PubMed ID = 38893565 ] [ RRC reference ]

Wu Z, Cardona EA, Pierce JT.
Non-apoptotic role of EGL-1 in exopher production and neuronal health in Caenorhabditis elegans.
bioRxiv 2024   
[ PubMed ID = 38712027 ] [ RRC reference ]

Chen TY, Wang FY, Lee PJ, Hsu AL, Ching TT.
Mitochondrial S-adenosylmethionine deficiency induces mitochondrial unfolded protein response and extends lifespan in Caenorhabditis elegans.
Aging Cell 2024 23(4) e14103 
[ PubMed ID = 38361361 ] [ RRC reference ]

Cooper JF, Nguyen K, Gates D, Wolfrum E, Capan C, Lee H, Williams D, Okoye C, Wojtovich AP, Burton NO.
Oocyte mitochondria link maternal environment to offspring phenotype.
Res Sq 2024   
[ PubMed ID = 38585755 ] [ RRC reference ]

Campbell D, Zuryn S.
The mechanisms and roles of mitochondrial dynamics in C. elegans.
Semin Cell Dev Biol 2024 156 266-275 
[ PubMed ID = 37919144 ] [ RRC reference ]

Michaeli L, Spector E, Haeussler S, Carvalho CA, Grobe H, Abu-Shach UB, Zinger H, Conradt B, Broday L.
ULP-2 SUMO protease regulates UPRmt and mitochondrial homeostasis in Caenorhabditis elegans.
Free Radic Biol Med 2024 214 19-27 
[ PubMed ID = 38301974 ] [ RRC reference ]

Sharifi S, Chaudhari P, Martirosyan A, Eberhardt AO, Witt F, Gollowitzer A, Lange L, Woitzat Y, Okoli EM, Li H, Rahnis N, Kirkpatrick J, Werz O, Ori A, Koeberle A, Bierhoff H, Ermolaeva M.
Reducing the metabolic burden of rRNA synthesis promotes healthy longevity in Caenorhabditis elegans.
Nat Commun 2024 15(1) 1702 
[ PubMed ID = 38402241 ] [ RRC reference ]

Power KM, Nguyen KC, Silva A, Singh S, Hall DH, Rongo C, Barr MM.
NEKL-4 regulates microtubule stability and mitochondrial health in C. elegans ciliated neurons.
bioRxiv 2024   
[ PubMed ID = 38405845 ] [ RRC reference ]