分離済み変異体

tm1107

Allele Name

tm1107

Allele Type

通常株

Sequence Name

D2013.5

Gene Name

eat-3

Worm Base

Allele Name

tm1107

Gene Name

eat-3

Sequence

D2013.5

Phenotype

lethal or sterile. Dr. D. Xue: Mol Cell 31, 586 (2008)

Mutation site

27442/27443-27859/27860 (417 bp deletion)

Chromosome

Putative gene structure

join(25280..25440, 26057..26198, 26334..26574, 26952..27187, 27235..27767, 27817..28315, 28406..28609, 28654..29106, 29160..29427, 29611..29678)

Map position

1.27

Balancer

Map position of balancer

Sequence of primers

ExtFwd:AGACCATGTGCTCACTCGGA,IntFwd:TCTAAGCACTCTTCACCTTG,ExtRev:ATCCCGTAGTAACTGGCTTG,IntRev:TCATCGATCGAATCCGAACT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Liu YJ, McIntyre RL, Janssens GE, Williams EG, Lan J, van Weeghel M, Schomakers B, van der Veen H, van der Wel NN, Yao P, Mair WB, Aebersold R, MacInnes AW, Houtkooper RH.
Mitochondrial translation and dynamics synergistically extend lifespan in C. elegans through HLH-30.
J Cell Biol 2020 219(6)
[ PubMed ID = 32259199 ] [ RRC reference ]

Machiela E, Liontis T, Dues DJ, Rudich PD, Traa A, Wyman L, Kaufman C, Cooper JF, Lew L, Nadarajan S, Senchuk MM, Van Raamsdonk JM.
Disruption of mitochondrial dynamics increases stress resistance through activation of multiple stress response pathways.
FASEB J 2020 34(6) 8475-8492
[ PubMed ID = 32385951 ] [ RRC reference ]

Fu H, Zhou H, Yu X, Xu J, Zhou J, Meng X, Zhao J, Zhou Y, Chisholm AD, Xu S.
Wounding triggers MIRO-1 dependent mitochondrial fragmentation that accelerates epidermal wound closure through oxidative signaling.
Nat Commun 2020 11(1) 1050
[ PubMed ID = 32103012 ] [ RRC reference ]

Weir HJ, Yao P, Huynh FK, Escoubas CC, Goncalves RL, Burkewitz K, Laboy R, Hirschey MD, Mair WB.
Dietary Restriction and AMPK Increase Lifespan via Mitochondrial Network and Peroxisome Remodeling.
Cell Metab 2017 26(6) 884-896.e5
[ PubMed ID = 29107506 ] [ RRC reference ]

Johnson D, Allman E, Nehrke K.
Regulation of acid-base transporters by reactive oxygen species following mitochondrial fragmentation.
Am J Physiol Cell Physiol 2012 302(7) C1045-54
[ PubMed ID = 22237403 ] [ RRC reference ]

Rolland SG, Motori E, Memar N, Hench J, Frank S, Winklhofer KF, Conradt B.
Impaired complex IV activity in response to loss of LRPPRC function can be compensated by mitochondrial hyperfusion.
Proc Natl Acad Sci U S A 2013 110(32) E2967-76
[ PubMed ID = 23878239 ] [ RRC reference ]

Johnson D, Nehrke K.
Mitochondrial fragmentation leads to intracellular acidification in Caenorhabditis elegans and mammalian cells.
Mol Biol Cell 2010 21(13) 2191-201
[ PubMed ID = 20444981 ] [ RRC reference ]

Breckenridge DG, Kang BH, Kokel D, Mitani S, Staehelin LA, Xue D.
Caenorhabditis elegans drp-1 and fis-2 regulate distinct cell-death execution pathways downstream of ced-3 and independent of ced-9.
Mol Cell 2008 31(4) 586-597
[ PubMed ID = 18722182 ] [ RRC reference ]

Kanazawa T, Zappaterra MD, Hasegawa A, Wright AP, Newman-Smith ED, Buttle KF, McDonald K, Mannella CA, van der Bliek AM.
The C. elegans Opa1 homologue EAT-3 is essential for resistance to free radicals.
PLoS Genet 2008 4(2) e1000022
[ PubMed ID = 18454199 ] [ RRC reference ]