| Allele Name | tm1097 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F20B4.6 |
| Gene Name | cgt-2 |
| Worm Base | Allele Name |
tm1097
|
| Gene Name |
cgt-2
|
| Sequence |
F20B4.6
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 9324/9325-9748/9749 (424 bp deletion) |
| Chromosome | X |
| Putative gene structure | join(6817..7064, 8321..8556, 8602..8822, 9048..9371, 10039..10170, 11596..11766) |
| Map position | 24.62 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CCACGCATCTTATGGCTGTA,IntFwd:TGCAGAAGGGAAGCAATCCT,ExtRev:GAAAGTATCGACTCCACCGT,IntRev:CCAACCCTTCACTACCCGGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Wang PZ, Ge MH, Su P, Wu PP, Wang L, Zhu W, Li R, Liu H, Wu JJ, Xu Y, Zhao JL, Li SJ, Wang Y, Chen LM, Wu TH, Wu ZX.
Sensory plasticity caused by up-down regulation encodes the information of short-term learning and memory.
iScience 2025 28(4) 112215
[ PubMed ID = 40224011 ]
[ RRC reference ]
|
Marza E, Simonsen KT, Faergeman NJ, Lesa GM.
Expression of ceramide glucosyltransferases, which are essential for glycosphingolipid synthesis, is only required in a small subset of C. elegans cells.
J Cell Sci 2009 122(Pt 6) 822-33
[ PubMed ID = 19240113 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.