| Allele Name | tm1094 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C01G5.2 |
| Gene Name | prg-2 |
| Worm Base | Allele Name |
tm1094
|
| Gene Name |
prg-2
|
| Sequence |
C01G5.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006). Dr. E. Miska; Mol Cell 31, 79-90 (2008). |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 14468/14469-AAACAAGTGTTTAACAATTAAACAAGT-15533/15534 (1065 bp deletion + 27 bp insertion) |
| Chromosome | IV |
| Putative gene structure | complement(join(13134..13289, 13335..13521, 13564..13801, 13849..14023, 14071..14435, 14479..14920, 14968..15210, 15380..15568, 15613..15786)) |
| Map position | 3.2 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:CGGGCCAACCATCAAAATGA,ExtRev:CTGGGAACTATCCAACCCGA,IntFwd:ATCTTACTTCGGACGAAGTG,ExtFwd:CAGCACCATCTCTGTAGAGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Ow MC, Nishiguchi MA, Dar AR, Butcher RA, Hall SE.
RNAi-dependent expression of sperm genes in ADL chemosensory neurons is required for olfactory responses in Caenorhabditis elegans.
Front Mol Biosci 2024 11 1396587
[ PubMed ID = 39055986 ]
[ RRC reference ]
|
Shukla A, Perales R, Kennedy S.
piRNAs coordinate poly(UG) tailing to prevent aberrant and perpetual gene silencing.
Curr Biol 2021 31(20) 4473-4485.e3
[ PubMed ID = 34428467 ]
[ RRC reference ]
|
Pereira AG, Gracida X, Kagias K, Zhang Y.
C. elegans aversive olfactory learning generates diverse intergenerational effects.
J Neurogenet 2020 34(3-4) 378-388
[ PubMed ID = 32940103 ]
[ RRC reference ]
|
Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32
[ PubMed ID = 24532782 ]
[ RRC reference ]
|
Batista PJ, Ruby JG, Claycomb JM, Chiang R, Fahlgren N, Kasschau KD, Chaves DA, Gu W, Vasale JJ, Duan S, Conte D Jr, Luo S, Schroth GP, Carrington JC, Bartel DP, Mello CC.
PRG-1 and 21U-RNAs interact to form the piRNA complex required for fertility in C. elegans.
Mol Cell 2008 31(1) 67-78
[ PubMed ID = 18571452 ]
[ RRC reference ]
|
Wang G, Reinke V.
A C. elegans Piwi, PRG-1, regulates 21U-RNAs during spermatogenesis.
Curr Biol 2008 18(12) 861-7
[ PubMed ID = 18501605 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.