| Allele Name | tm1092 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F07G6.1 |
| Gene Name | dgn-3 |
| Worm Base | Allele Name |
tm1092
|
| Gene Name |
dgn-3
|
| Sequence |
F07G6.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. S. McIntire: normal development and locomotion. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 27727/27728-28456/28457 (729 bp deletion) |
| Chromosome | X |
| Putative gene structure | join(27429..27742, 28949..29363, 29478..29629, 29675..29789) |
| Map position | -17.65 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GCGAGCTTATGAGAGCCCTA,IntFwd:CTCCGAGCTGACACTTGGAT,IntRev:TCTTCCAGCACTGCGTTTCT,ExtRev:TGTCGCCACTCTCCGATAGT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Teuscher AC, Statzer C, Goyala A, Domenig SA, Schoen I, Hess M, Hofer AM, Fossati A, Vogel V, Goksel O, Aebersold R, Ewald CY.
Longevity interventions modulate mechanotransduction and extracellular matrix homeostasis in C. elegans.
Nat Commun 2024 15(1) 276
[ PubMed ID = 38177158 ]
[ RRC reference ]
|
Qin J, Liang J, Ding M.
Perlecan antagonizes collagen IV and ADAMTS9/GON-1 in restricting the growth of presynaptic boutons.
J Neurosci 2014 34(31) 10311-24
[ PubMed ID = 25080592 ]
[ RRC reference ]
|
Trzebiatowska A, Topf U, Sauder U, Drabikowski K, Chiquet-Ehrismann R.
Caenorhabditis elegans teneurin, ten-1, is required for gonadal and pharyngeal basement membrane integrity and acts redundantly with integrin ina-1 and dystroglycan dgn-1.
Mol Biol Cell 2008 19(9) 3898-908
[ PubMed ID = 18632986 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.