Home > 分離済み変異体 > tm1053

分離済み変異体

Allele Name		tm1053
Balance		Not Required
OutCross		Not Accepted
Sequence Name		C17C3.4
Gene Name		ins-11
Worm Base	Allele Name	tm1053
	Gene Name	ins-11
	Sequence	C17C3.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. T. Katada: No abnormal proliferation in Z2/Z3 cells during L1 diapause. Dr. K. Ashrafi: normal Nile Red staining. Dr. J. Kaplan: normal nile red staining. Dr. C-S. Chen: normal sensitivity to Bacillus pore-forming toxin.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		26387/26388-26728/26729 (341 bp deletion)
Chromosome		II
Putative gene structure		join(26652..26817, 26870..26979)
Map position		-1.15
Balancer
Map position of balancer
Sequence of primers		IntFwd:ACACATCATGGCACTTCGAA,ExtFwd:CGTACGGGGGCATTTTTAGA,ExtRev:GCGCATGGAGAGCCAATATT,IntRev:AGGCGGGGAAGAGACGCAAA
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Matty MA, Lau HE, Haley JA, Singh A, Chakraborty A, Kono K, Reddy KC, Hansen M, Chalasani SH. Intestine-to-neuronal signaling alters risk-taking behaviors in food-deprived Caenorhabditis elegans. PLoS Genet 2022 18(5) e1010178  [ PubMed ID = 35511794 ] [ RRC reference ] Kim S, Sieburth D. A Receptor Tyrosine Kinase Network Regulates Neuromuscular Function in Response to Oxidative Stress in Caenorhabditis elegans. Genetics 2019 211(4) 1283-1295  [ PubMed ID = 30782598 ] [ RRC reference ] Lee SH, Omi S, Thakur N, Taffoni C, Belougne J, Engelmann I, Ewbank JJ, Pujol N. Modulatory upregulation of an insulin peptide gene by different pathogens in C. elegans. Virulence 2018 9(1) 648-658  [ PubMed ID = 29405821 ] [ RRC reference ] Lee K, Mylonakis E. An Intestine-Derived Neuropeptide Controls Avoidance Behavior in Caenorhabditis elegans. Cell Rep 2017 20(10) 2501-2512  [ PubMed ID = 28877481 ] [ RRC reference ] Labocha MK, Yuan W, Aleman-Meza B, Zhong W. A strategy to apply quantitative epistasis analysis on developmental traits. BMC Genet 2017 18(1) 42  [ PubMed ID = 28506208 ] [ RRC reference ] Ludewig AH, Gimond C, Judkins JC, Thornton S, Pulido DC, Micikas RJ, Döring F, Antebi A, Braendle C, Schroeder FC. Larval crowding accelerates C. elegans development and reduces lifespan. PLoS Genet 2017 13(4) e1006717  [ PubMed ID = 28394895 ] [ RRC reference ] Burton NO, Furuta T, Webster AK, Kaplan RE, Baugh LR, Arur S, Horvitz HR. Insulin-like signalling to the maternal germline controls progeny response to osmotic stress. Nat Cell Biol 2017 19(3) 252-257  [ PubMed ID = 28166192 ] [ RRC reference ] Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q. An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology. PLoS Genet 2014 10(3) e1004225  [ PubMed ID = 24675767 ] [ RRC reference ] Maures TJ, Booth LN, Benayoun BA, Izrayelit Y, Schroeder FC, Brunet A. Males shorten the life span of C. elegans hermaphrodites via secreted compounds. Science 2014 343(6170) 541-4  [ PubMed ID = 24292626 ] [ RRC reference ] Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR. A database of Caenorhabditis elegans behavioral phenotypes. Nat Methods 2013 10(9) 877-9  [ PubMed ID = 23852451 ] [ RRC reference ] Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M. Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development. EMBO J 2013 32(12) 1745-60  [ PubMed ID = 23665919 ] [ RRC reference ] Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y. Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans. PLoS Genet 2013 9(5) e1003472  [ PubMed ID = 23658528 ] [ RRC reference ] Evans EA, Kawli T, Tan MW. Pseudomonas aeruginosa suppresses host immunity by activating the DAF-2 insulin-like signaling pathway in Caenorhabditis elegans. PLoS Pathog 2008 4(10) e1000175  [ PubMed ID = 18927620 ] [ RRC reference ] Kawano T, Nagatomo R, Kimura Y, Gengyo-Ando K, Mitani S. Disruption of ins-11, a Caenorhabditis elegans insulin-like gene, and phenotypic analyses of the gene-disrupted animal. Biosci Biotechnol Biochem 2006 70(12) 3084-7  [ PubMed ID = 17151440 ] [ RRC reference ]