分離済み変異体

tm1050

Allele Nametm1050
BalanceNot Required
OutCrossNot Accepted
Sequence NameY39D8C.1
Gene Nameabt-4
Worm BaseAllele Name tm1050
Gene Name abt-4
Sequence Y39D8C.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. L. Timmons: negative for RNAi defects using various feeding strains to deliver dsRNA.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3943/3944-GTACT-4373/4374 (430 bp deletion + 5 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(116..558, 603..888, 1143..1449, 1508..1914, 1963..2435, 2491..2587, 2684..2784, 2830..3017, 3064..3625, 3670..3834, 3882..4632, 4681..5619, 5670..5776, 5926..6168, 6255..6459, 6796..6930))
Map position-20
Balancer
Map position of balancer
Sequence of primersExtFwd:AGTGAAGCCTGTTACGCGGA,IntFwd:CGCGGAGGTCTTGTAAAATC,IntRev:CCAAGTATCGAGATTCCCGT,ExtRev:ACCCCGCTTCTCGATTCCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]

Sundaram P, Han W, Cohen N, Echalier B, Albin J, Timmons L.
Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7.
Genetics 2008 178(2) 801-14 
[ PubMed ID = 18245353 ] [ RRC reference ]