| Allele Name | tm1050 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | Y39D8C.1 |
| Gene Name | abt-4 |
| Worm Base | Allele Name |
tm1050
|
| Gene Name |
abt-4
|
| Sequence |
Y39D8C.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. L. Timmons: negative for RNAi defects using various feeding strains to deliver dsRNA. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 3943/3944-GTACT-4373/4374 (430 bp deletion + 5 bp insertion) |
| Chromosome | V |
| Putative gene structure | complement(join(116..558, 603..888, 1143..1449, 1508..1914, 1963..2435, 2491..2587, 2684..2784, 2830..3017, 3064..3625, 3670..3834, 3882..4632, 4681..5619, 5670..5776, 5926..6168, 6255..6459, 6796..6930)) |
| Map position | -20 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:AGTGAAGCCTGTTACGCGGA,IntFwd:CGCGGAGGTCTTGTAAAATC,IntRev:CCAAGTATCGAGATTCCCGT,ExtRev:ACCCCGCTTCTCGATTCCTA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25
[ PubMed ID = 23173093 ]
[ RRC reference ]
|
Sundaram P, Han W, Cohen N, Echalier B, Albin J, Timmons L.
Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7.
Genetics 2008 178(2) 801-14
[ PubMed ID = 18245353 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.