| Allele Name | tm1049 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C10C6.1 |
| Gene Name | kin-4 |
| Worm Base | Allele Name |
tm1049
|
| Gene Name |
kin-4
|
| Sequence |
C10C6.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. K. Shen: Normal HSN vulval presynaptic vesicle clusters (unc-86::SNB-1::YFP), no obvious egg laying defects. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 5784/5785-TTTTTTCTGTAAAAAAATTCAAAAAAATTCA-7256/7257 (1472 bp deletion + 31 bp insertion) |
| Chromosome | IV |
| Putative gene structure | join(3680..3921, 3972..4248, 5463..5648, 6106..6319, 6367..6533, 6580..6950, 7003..7155, 7208..7346, 7392..7629, 7680..7831, 7877..8029, 8076..8522, 9034..9819, 9889..10157, 10576..10894) |
| Map position | 4.98 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:ACACACGGCTCCCATCTGTT,IntFwd:GCTCCCATCTGTTTGCTTTG,ExtRev:CTGGATACTCGACGTCTTCA,IntRev:CGTACAGGATAATTCCGAGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Roumbo L, Ossareh-Nazari B, Vigneron S, Stefani I, Van Hove L, Legros V, Chevreux G, Lacroix B, Castro A, Joly N, Lorca T, Pintard L. The MAST kinase KIN-4 carries out mitotic entry functions of Greatwall in C. elegans. EMBO J 2025 44(7) 1943-1974
[ PubMed ID = 39962268 ]
[ RRC reference ]
|
Nakano S, Nakayama A, Kuroyanagi H, Yamashiro R, Tsukada Y, Mori I. Genetic screens identified dual roles of microtubule-associated serine threonine kinase and CREB within a single thermosensory neuron in the regulation of Caenorhabditis elegans thermotaxis behavior. G3 (Bethesda) 2022 12(11)
[ PubMed ID = 36102820 ]
[ RRC reference ]
|
An SWA, Choi ES, Hwang W, Son HG, Yang JS, Seo K, Nam HJ, Nguyen NTH, Kim EJE, Suh BK, Kim Y, Nakano S, Ryu Y, Man Ha C, Mori I, Park SK, Yoo JY, Kim S, Lee SV. KIN-4/MAST kinase promotes PTEN-mediated longevity of Caenorhabditis elegans via binding through a PDZ domain. Aging Cell 2019 18(3) e12906
[ PubMed ID = 30773781 ]
[ RRC reference ]
|
|