分離済み変異体

tm1049

Allele Nametm1049
BalanceNot Required
OutCrossNot Accepted
Sequence NameC10C6.1
Gene Namekin-4
Worm BaseAllele Name tm1049
Gene Name kin-4
Sequence C10C6.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. K. Shen: Normal HSN vulval presynaptic vesicle clusters (unc-86::SNB-1::YFP), no obvious egg laying defects.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 5784/5785-TTTTTTCTGTAAAAAAATTCAAAAAAATTCA-7256/7257 (1472 bp deletion + 31 bp insertion)
ChromosomeIV
Putative gene structurejoin(3680..3921, 3972..4248, 5463..5648, 6106..6319, 6367..6533, 6580..6950, 7003..7155, 7208..7346, 7392..7629, 7680..7831, 7877..8029, 8076..8522, 9034..9819, 9889..10157, 10576..10894)
Map position4.98
Balancer
Map position of balancer
Sequence of primersExtFwd:ACACACGGCTCCCATCTGTT,IntFwd:GCTCCCATCTGTTTGCTTTG,ExtRev:CTGGATACTCGACGTCTTCA,IntRev:CGTACAGGATAATTCCGAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Roumbo L, Ossareh-Nazari B, Vigneron S, Stefani I, Van Hove L, Legros V, Chevreux G, Lacroix B, Castro A, Joly N, Lorca T, Pintard L.
The MAST kinase KIN-4 carries out mitotic entry functions of Greatwall in C. elegans.
EMBO J 2025 44(7) 1943-1974 
[ PubMed ID = 39962268 ] [ RRC reference ]

Nakano S, Nakayama A, Kuroyanagi H, Yamashiro R, Tsukada Y, Mori I.
Genetic screens identified dual roles of microtubule-associated serine threonine kinase and CREB within a single thermosensory neuron in the regulation of Caenorhabditis elegans thermotaxis behavior.
G3 (Bethesda) 2022 12(11)  
[ PubMed ID = 36102820 ] [ RRC reference ]

An SWA, Choi ES, Hwang W, Son HG, Yang JS, Seo K, Nam HJ, Nguyen NTH, Kim EJE, Suh BK, Kim Y, Nakano S, Ryu Y, Man Ha C, Mori I, Park SK, Yoo JY, Kim S, Lee SV.
KIN-4/MAST kinase promotes PTEN-mediated longevity of Caenorhabditis elegans via binding through a PDZ domain.
Aging Cell 2019 18(3) e12906 
[ PubMed ID = 30773781 ] [ RRC reference ]