分離済み変異体

tm1036

Allele Nametm1036
BalanceNot Required
OutCrossNot Accepted
Sequence NameF43G9.11
Gene Nameces-1
Worm BaseAllele Name tm1036
Gene Name ces-1
Sequence F43G9.11
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 28962/28963-30248/30249 (1286 bp deletion)
ChromosomeI
Putative gene structurejoin(28790..28865, 29181..29484, 29536..29617, 29718..29797, 30561..30745, 30800..30885)
Map position3.01
Balancer
Map position of balancer
Sequence of primersIntRev:CTGGTTGCTAGTTTCACTAC,ExtRev:GTGAACACTTAGCCCCAGCT,ExtFwd:TGTCCCATCTGCCTGCATGA,IntFwd:ATTGAGCGAGCTTAAACGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Park L, Luth ES, Jones K, Hofer J, Nguyen I, Watters KE, Juo P.
The Snail transcription factor CES-1 regulates glutamatergic behavior in C. elegans.
PLoS One 2021 16(2) e0245587 
[ PubMed ID = 33529210 ] [ RRC reference ]

Wei H, Lambie EJ, Osório DS, Carvalho AX, Conradt B.
PIG-1 MELK-dependent phosphorylation of nonmuscle myosin II promotes apoptosis through CES-1 Snail partitioning.
PLoS Genet 2020 16(9) e1008912 
[ PubMed ID = 32946434 ] [ RRC reference ]

Wei H, Yan B, Gagneur J, Conradt B.
Caenorhabditis elegans CES-1 Snail Represses pig-1 MELK Expression To Control Asymmetric Cell Division.
Genetics 2017 206(4) 2069-2084 
[ PubMed ID = 28652378 ] [ RRC reference ]

Guo B, Liang Q, Li L, Hu Z, Wu F, Zhang P, Ma Y, Zhao B, Kovács AL, Zhang Z, Feng D, Chen S, Zhang H.
O-GlcNAc-modification of SNAP-29 regulates autophagosome maturation.
Nat Cell Biol 2014 16(12) 1215-26 
[ PubMed ID = 25419848 ] [ RRC reference ]

Yan B, Memar N, Gallinger J, Conradt B.
Coordination of cell proliferation and cell fate determination by CES-1 snail.
PLoS Genet 2013 9(10) e1003884 
[ PubMed ID = 24204299 ] [ RRC reference ]