分離済み変異体

tm1034

Allele Nametm1034
BalanceNot Required
OutCrossNot Accepted
Sequence NameY49E10.11
Gene Nametat-1
Worm BaseAllele Name tm1034
Gene Name tat-1
Sequence Y49E10.11
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Han: normal growth rate. Dr. S. Tuck: Traffick 10, 88 (2009).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 47578/47579-A-48175/48176 (597 bp deletion + 1 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(31959..32056, 32642..32766, 37381..37473, 38318..38574, 39898..40038, 40248..40381, 40524..40678, 42286..42815, 44720..45258, 46349..46649, 47456..47568, 48159..48398, 50066..50372, 51442..51627, 52670..52769, 52820..52877, 53218..53260))
Map position17.57
Balancer
Map position of balancer
Sequence of primersExtFwd:CCAGTATGACAAACAGCCAT,IntFwd:CACATTCCGTGTAAGAGTGC,ExtRev:CTACACTGGACACGACTCAA,IntRev:ACGACTCAAAGCTGCTCATG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Raiders S, Black EC, Bae A, MacFarlane S, Klein M, Shaham S, Singhvi A.
Glia actively sculpt sensory neurons by controlled phagocytosis to tune animal behavior.
Elife 2021 10  
[ PubMed ID = 33759761 ] [ RRC reference ]

Denning DP, Hatch V, Horvitz HR.
Both the caspase CSP-1 and a caspase-independent pathway promote programmed cell death in parallel to the canonical pathway for apoptosis in Caenorhabditis elegans.
PLoS Genet 2013 9(3) e1003341 
[ PubMed ID = 23505386 ] [ RRC reference ]

Nawa M, Kage-Nakadai E, Aiso S, Okamoto K, Mitani S, Matsuoka M.
Reduced expression of BTBD10, an Akt activator, leads to motor neuron death.
Cell Death Differ 2012 19(8) 1398-407 
[ PubMed ID = 22388351 ] [ RRC reference ]

Wang X, Li W, Zhao D, Liu B, Shi Y, Chen B, Yang H, Guo P, Geng X, Shang Z, Peden E, Kage-Nakadai E, Mitani S, Xue D.
Caenorhabditis elegans transthyretin-like protein TTR-52 mediates recognition of apoptotic cells by the CED-1 phagocyte receptor.
Nat Cell Biol 2010 12(7) 655-64 
[ PubMed ID = 20526330 ] [ RRC reference ]

Seamen E, Blanchette JM, Han M.
P-type ATPase TAT-2 negatively regulates monomethyl branched-chain fatty acid mediated function in post-embryonic growth and development in C. elegans.
PLoS Genet 2009 5(8) e1000589 
[ PubMed ID = 19662161 ] [ RRC reference ]

Ruaud AF, Nilsson L, Richard F, Larsen MK, Bessereau JL, Tuck S.
The C. elegans P4-ATPase TAT-1 regulates lysosome biogenesis and endocytosis.
Traffic 2009 10(1) 88-100 
[ PubMed ID = 18939953 ] [ RRC reference ]

Darland-Ransom M, Wang X, Sun CL, Mapes J, Gengyo-Ando K, Mitani S, Xue D.
Role of C. elegans TAT-1 protein in maintaining plasma membrane phosphatidylserine asymmetry.
Science 2008 320(5875) 528-31 
[ PubMed ID = 18436785 ] [ RRC reference ]