| Allele Name | tm10110 |
| Balance | Not Required |
| OutCross | Request Available |
| Sequence Name | C43F9.9 |
| Gene Name | lgc-43 |
| Worm Base | Allele Name |
tm10110
|
| Gene Name |
lgc-43
|
| Sequence |
C43F9.9
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 16639/16640-16775/16776 (136 bp deletion) |
| Chromosome | IV |
| Putative gene structure | join(13938..14010, 14129..14223, 14274..14853, 14905..15177, 15225..15339, 15481..15654, 15709..15791, 15841..15972, 16118..16278, 16572..16925) |
| Map position | 4.64 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TCCTATCACAGTGAGCTGAC,ExtRev:GAAGTGTACTACTGGCGTTA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Zou W, Fan Y, Liu J, Cheng H, Hong H, Al-Sheikh U, Li S, Zhu L, Li R, He L, Tang YQ, Zhao G, Zhang Y, Wang F, Zhan R, Zheng X, Kang L.
Anoctamin-1 is a core component of a mechanosensory anion channel complex in C. elegans.
Nat Commun 2025 16(1) 1680
[ PubMed ID = 39956854 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.